# RNA Sequence

Key: `representation.scientific.rna_sequence`

Ribonucleic acid sequence in IUPAC notation (letters: A, U, G, C, and ambiguity codes).

Page: <https://meridian.online/docs/projects/finetype/types/representation/scientific/rna_sequence>

Samples: `AUGCAGC`, `GCUAGCUAGCUAG`, `AUGAUGAUG`

## Background

### Origin

An RNA sequence is written as a succession of the letters G, A, C and U, one per nucleotide.[[1]](https://en.wikipedia.org/wiki/Nucleic_acid_sequence) In RNA, uracil base-pairs with adenine and replaces thymine during DNA transcription.[[2]](https://en.wikipedia.org/wiki/Uracil) By convention, nucleic acid sequences are usually presented from the 5' end to the 3' end.[[1]](https://en.wikipedia.org/wiki/Nucleic_acid_sequence) Robert W. Holley's alanine transfer RNA structure, completed in 1964, was the first nucleotide sequence of a ribonucleic acid ever determined.[[3]](https://en.wikipedia.org/wiki/Robert_W._Holley)

### Use

The FASTA format originated from the FASTA software package and has since become a near-universal standard in bioinformatics.[[4]](https://en.wikipedia.org/wiki/FASTA_format) A FASTA record begins with a single-line description, followed by lines of sequence data.[[5]](https://blast.ncbi.nlm.nih.gov/doc/blast-topics/) NCBI BLAST accepts lower-case letters in a FASTA sequence and maps them into upper-case.[[5]](https://blast.ncbi.nlm.nih.gov/doc/blast-topics/)

In RNA there are many modified bases, including pseudouridine (Ψ), dihydrouridine (D) and inosine (I).[[1]](https://en.wikipedia.org/wiki/Nucleic_acid_sequence)

### Where you'll meet it

miRBase's entry for hsa-let-7a-5p gives its mature sequence as UGAGGUAGUAGGUUGUAUAGUUU, written with U.[[6]](https://www.mirbase.org/mature/MIMAT0000062) RNAcentral's API returns the sequence of a Homo sapiens pre-miRNA, URS000075A685, written with U.[[7]](https://rnacentral.org/api/v1/rna/URS000075A685)

## Sources

1. [Nucleic acid sequence - Wikipedia](https://en.wikipedia.org/wiki/Nucleic_acid_sequence) — secondary source
2. [Uracil - Wikipedia](https://en.wikipedia.org/wiki/Uracil) — secondary source
3. [Robert W. Holley - Wikipedia](https://en.wikipedia.org/wiki/Robert_W._Holley) — secondary source
4. [FASTA format - Wikipedia](https://en.wikipedia.org/wiki/FASTA_format) — secondary source
5. [Query Input and database selection — BlastTopics 0.1.1 documentation](https://blast.ncbi.nlm.nih.gov/doc/blast-topics/) — documentation
6. [miRBase entry: hsa-let-7a-5p](https://www.mirbase.org/mature/MIMAT0000062) — dataset
7. [RNAcentral API](https://rnacentral.org/api/v1/rna/URS000075A685) — dataset